Journal: Cell

Article Title: Deciphering the "m 6 A Code" via Antibody-Independent Quantitative Profiling.

doi: 10.1016/j.cell.2019.06.013

Figure Lengend Snippet: Figure 4. Systematic Validation of Model via Experimentally Induced and Natural Perturbations (A) Scheme depicting the experimental approach to introduce and measure m6A levels at hundreds of variants. (B) Correlations of predicted methylation levels with cleavage efficiencies. (C) Scatterplots depicting the correlations between predicted methylation levels and between the relative abundance of each variant at the indicated time points with respect to the 0-h time point. (D) Correlation between the difference in predicted methylation of orthologous m6A consensus motifs between SK1 and S. mikatae (Dprediction, x axis) and the difference in m6A-seq scores at the same sites between SK1 and S. mikatae (Dm6A-seq score, y axis). Each site is plotted as a circle if the sequence divergence in the 9-bp window centered around the methylation site is 1 bp or a triangle if the divergence is 2 bp. The color of each point reflects whether the core sequence

Article Snippet: Systematic perturbation of m6A consensus sequence To systematically modify sequences surrounding an m6A site in the 30 UTR of of the GIP2 gene (chr5:268382 in the sk1 genome), yeast were co-transformed with a CRISPR/Cas9 plasmid (pV1382, Addgene) carrying the following gRNA sequence: AAAAG GAAGGTGATGAAGAA), and with a set of 256 repair templates using the following DNA primer: GGCAGCATGAAGGCAACCAAAAG GAAGGTGGAAAAGANRRGACANNAAAAGCAAAATGACTTGCTAGATCTTGGCCTGAG.

Techniques: Biomarker Discovery, Introduce, Methylation, Variant Assay, Sequencing